RegulonDB RegulonDB 10.9: Gene Sequence
yegV gene sequence


Size: 966        A: 192  T: 224  G: 304  C: 246

Fasta

 

>yegV E. coli K12. Version NC_000913.3 GI:556503834
atgagcggcgctcgattacacacgctgctgcctgaattaaccacgcgtcagtcggtgatg
gtcgtcggcgcggcggtcattgacgtgatcgccgacgcttatgccctcccctggcgtggg
tgcgatatcgaactgaaacagcagagcgttaacgttggcggctgcgcactgaatattgcc
gtggcgttaaagcgcctcggcatcgaagcgggtaatgccttgccgctcggtcagggcgtg
tgggcggagatgattcgcaaccggatggcaaaagagggcttaatcagcctgatcgataac
gccgaaggtgataacggctggtgtctggcgctggttgagccggatggcgaacgcactttt
atgtcattcagcggtgttgaaaatcagtggaatcgccagtggctggcgcgattaaccgtt
gcgcctggcagcctgctctatttttccggttatcaactggcctcgccctgcggcgaattg
ttagtggaatggctggaagagctgcaagacgtgacgccgtttatcgattttggcccacgt
attggcgatatcccggatgcattactggcgcggatcatggcctgtcgacctttagtgtcg
ctcaatcgtcaagaggctgagattgccgccgaacgttttgctttatccgcagagataaca
acacttggcaagcaatggcaggagaaatttgccgcgccgttgatcgttcgtctcgataaa
gaaggcgcatggtatttcagcaacgacgcttctggctgcattccggcatttccaacgcaa
gttgtcgacaccattggggcgggcgacagtcatgccggtggcgtacttgccgggctggcc
tctggtctgccactggcggatgccgtattactgggcaatgcagtggcgtcgtgggttgtc
gggcatcggggcggtgattgtgcgccaacgcgcgaggaactactcctcgcacacaaaaac
gtatag
              
                            

Download fasta file
RegulonDB