RegulonDB RegulonDB 10.9: Gene Sequence
yegX gene sequence


Size: 819        A: 209  T: 217  G: 211  C: 182

Fasta

 

>yegX E. coli K12. Version NC_000913.3 GI:556503834
atgcagctaagaattaccagtcgaaaaaaactcacctctctattatgcgctcttgggcta
atttccatcgttgcaatttatccgcgtcagacggtgaattttttctattcgacagcagtt
cagattacagactacatccacttctacggttatcgcccggttaaatctttcgctattcgc
attcctgccagttacaccattcacggaatagatgtttcgcgctggcaggagcggatcgac
tggcagcgggtggcaaaaatgcgcgacaatggtatccgcttacagtttgcttttattaag
gcgacggaaggcgaaaagctggtggacccctatttttcgcgtaactggcaactaagccgc
gaaaatggcctgctgcgtggggcgtatcattatttctccccgtcggtatccgcttcagtt
caggcgagattatttctgcaaacggtggatttctcacaaggcgatttccctgccgtgctg
gacgtagaagaacggggaaaattatcggcaaaagaattacgcaagcgggtaagtcagtgg
ctaaaaatggtcgaaaaaagtacggggaaaaagccgattatttactcaggagccgttttt
tatcacaccaatctggcgggctatttcaatgaatatccgtggtgggtggctcactactat
caacgtcgtccggacaatgacggaatggcctggcgcttctggcagcattccgaccgtgga
caggtagatggcatcaatggtccggtggattttaatgtatttaatggcacggtggaggag
ttgcaggcattcgttgatgggattaaagaaacgccttaa
              
                            

Download fasta file
RegulonDB