RegulonDB RegulonDB 10.9: Gene Sequence
rcnA gene sequence


Size: 825        A: 196  T: 204  G: 208  C: 217

Fasta

 

>rcnA E. coli K12. Version NC_000913.3 GI:556503834
atgaccgaatttacaactcttcttcagcaaggaaacgcctggttcttcatccccagcgcc
atcttacttggtgcgcttcatggcctggaaccagggcactcaaaaacgatgatggcggcg
tttatcatcgccatcaaaggcaccattaaacaagcggtgatgctcggactggcagcaact
atttcgcataccgcagtggtctggttaattgcctttggcgggatggtgatcagcaagcgc
tttactgctcaatcagcagaaccgtggctccagctgatttccgcagtgatcattattagc
accgcgttctggatgttctggcgtacctggcgcggcgaacgcaactggctggagaatatg
cacgggcatgattatgagcatcatcatcacgatcacgaacatcaccacgaccatggacat
catcaccatcacgaacatggcgagtatcaggatgcccatgcacgagcccatgccaatgac
attaaacgacgctttgatggtagagaggtcaccaactggcaaattttgttatttggctta
accggtggccttatcccctgcccggcagcaattaccgtgctgttgatatgcattcagttg
aaagccctgacactgggcgcaacactggtcgtcagtttcagcattggcctggcgttaacg
cttgtcaccgtaggcgttggcgcagcaatcagcgttcagcaggtcgcaaaacgctggagc
ggatttaacactctcgctaaacgcgccccctatttttccagtctgttgattggcttagtc
ggtgtgtatatgggcgtacatggcttcatgggcataatgcgataa
              
                            

Download fasta file
RegulonDB