RegulonDB RegulonDB 10.9: Gene Sequence
yeiS gene sequence


Size: 240        A: 53  T: 84  G: 57  C: 46

Fasta

 

>yeiS E. coli K12. Version NC_000913.3 GI:556503834
atggatgtacagcagttttttgtcgttgccgtttttttccttatcccgatattttgtttc
cgcgaagcatggaaaggctggcgcgcaggcgcgattgataaacgggttaaaaatgcaccg
gaaccggtgtatgtctggcgagcaaaaaatcccggactctttttcgcttatatggtggca
tatatcggcttcggaattttatctatcggcatgattgtttatcttattttctatcgttaa
              
                            

Download fasta file
RegulonDB