RegulonDB RegulonDB 10.9: Gene Sequence
preT gene sequence


Size: 1239        A: 315  T: 286  G: 337  C: 301

Fasta

 

>preT E. coli K12. Version NC_000913.3 GI:556503834
atgccgcaacaaaattatctggatgaactcactccggcttttacgtctttactggcgatt
aaagaagcctctcgctgtttattatgtcacgacgctccctgtagtcaggcttgcccggca
cagaccgatccggggaaatttattcgctcaatctactttcgtaattttaaaggcgctgcc
gagacaattcgcgaaaataatgccctcggtgccgtttgtgccagagtgtgcccgacggag
aaattatgccaaagcggttgtacccgtgccggtgttgatgctcccattgatatcggccgc
ttacagcgttttgttactgattttgaacaacaaaccggaatggaaatttatcagcccggt
actaaaacgctcggcaaagtcgcgattattggcgcaggtcctgccggattgcaggccagt
gtgacactgacaaaccagggttatgacgtcacgatttatgagaaagaagcgcaccccggt
ggctggttgcgtaacggtattccgcaattccggttaccgcaatcagtgctggatgcagag
atcgcccgtattgaaaaaatgggcgtgaccattaagtgcaacaacgaagtcggtaacaca
ctcacccttgagcagctgaaagcagaaaaccgcgcggtactggtcaccgtggggttatca
agcggttccgggctaccgctgtttgagcatagtgacgttgagattgccgtcgacttcttg
caacgtgcacgacaggcgcaaggcgatatcagcattccacaaagcgcattaattatcggc
ggcggtgatgtcgcgatggacgtagccagcacgctgaaagttctcggctgtcaggcggta
acttgcgtagcgcgtgaagagttagatgagtttccggcaagcgaaaaagagtttaccagc
gcccgggagctgggcgtttcgatcatcgatggattcacgccagtagccgtggaaggcaat
aaagtcacgtttaagcatgtacggttatcgggcgaactgacgatggcggcagataaaatt
attctcgccgtcggtcagcatgccagactagatgcctttgcggagttagagccgcagcgt
aacaccatcaaaacacaaaattaccagacccgcgacccgcaagtctttgctgctggcgat
attgttgagggtgacaaaaccgtggtctatgccgtgaaaaccgggaaagaagccgccgag
gcgattcatcactatttagagggagcttgctcatgttaa
              
                            

Download fasta file
RegulonDB