RegulonDB RegulonDB 10.9: Gene Sequence
mepS gene sequence


Size: 567        A: 147  T: 155  G: 142  C: 123

Fasta

 

>mepS E. coli K12. Version NC_000913.3 GI:556503834
atggtcaaatctcaaccgattttgagatatatcttgcgcgggattcccgcgattgcagta
gcggttctgctttctgcatgtagtgcaaataacaccgcaaagaatatgcatcctgagaca
cgtgcagtgggtagtgaaacatcatcactgcaagcttctcaggatgaatttgaaaacctg
gttcgtaatgtcgacgtaaaatcgcgaattatggatcagtatgctgactggaaaggcgta
cgttatcgtctgggcggcagcactaaaaaaggtatcgattgttctggtttcgtacagcgt
acattccgtgagcaatttggcttagaacttccgcgttcgacttacgaacagcaggaaatg
ggtaaatctgtttcccgcagtaatttgcgtacgggtgatttagttctgttccgtgccggt
tcaacgggacgccatgtcggtatttatatcggcaacaatcagtttgtccatgcttccacc
agcagtggtgttattatttccagcatgaatgaaccgtactggaagaagcgttacaacgaa
gcacgccgggttctcagccgcagctaa
              
                            

Download fasta file
RegulonDB