RegulonDB RegulonDB 10.9: Gene Sequence
pdeN gene sequence


Size: 1557        A: 384  T: 386  G: 381  C: 406

Fasta

 

>pdeN E. coli K12. Version NC_000913.3 GI:556503834
atgttcatacgcgctcccaattttggacgtaagctcctgcttacctgcattgttgcaggc
gtaatgattgcgatactggtgagttgccttcagtttttagtggcctggcataagcacgaa
gtcaaatacgacacactgattaccgacgtacaaaagtatctcgatacctattttgccgac
ctgaaatccactactgaccggctccagccgctgaccttagatacctgccagcaagctaac
cccgaactgaccgcccgcgcagcgtttagcatgaatgtccgaacgtttgtgctggtgaaa
gataaaaaaacattctgttcatctgcgaccggtgagatggacattccactcaatgaattg
attccggcgctcgacattaataaaaacgtcgatatggcgatcttacccggcacgccgatg
gtgccgaacaaacccgcaatcgtcatctggtatcgcaaccctttgctgaaaaatagcggc
gtctttgccgctctgaatctcaacctgacgccttcactcttttatagttcacggcaggaa
gattacgatggcgtcgccctcattattggcaatactgcgctatctaccttttcttcacgt
ttgatgaacgttaacgaattaaccgacatgccagtccgtgaaactaaaattgcgggcatt
cctctgaccgttcggctttatgcagatgactggacatggaacgatgtgtggtacgcattt
ttactgggcggcatgagtggaactgtcgttggcctgctctgctattacctgatgagcgta
cgtatgcgccccggcagagaaatcatgaccgccatcaagcgcgaacaattttacgtggcg
tatcaaccggtggtggatacacaagctttgcgagtaacgggcctggaagtactgctacgc
tggcggcatcctgtcgcgggagaaattcccccggatgccttcattaactttgccgaatcg
caaaagatgattgtgccgctgactcagcacctgtttgagttaattgcccgcgatgccgca
gaattagaaaaagtgctgccggtaggcgtcaaatttggtattaacattgcgccggaccat
ctgcacagcgaaagctttaaagcagatatccagaaactgctcacttccctgcccgcacac
catttccagattgtgctggaaattaccgagcgcgatatgttgaaagagcaagaagccaca
caactcttcgcctggctgcactcggtcggcgtagaaattgctattgatgacttcggcacc
gggcacagcgcgcttatctatcttgagcgttttacgctcgattatctgaaaattgaccgt
ggatttatcaacgccatcggtacggaaacgatcacttcccccgtacttgacgcggtgctg
acgctggcgaaacgcctcaatatgctgacggttgctgaaggggtcgaaacgccggaacag
gcgcgatggctaagcgaacgcggcgttaatttcatgcaaggctactggattagccgcccg
ttaccgctggacgattttgttcgctggctaaagaaaccgtatacgccgcagtggtaa
              
                            

Download fasta file
RegulonDB