RegulonDB RegulonDB 10.8: Gene Sequence
yfaP gene sequence


Size: 777        A: 196  T: 173  G: 218  C: 190

Fasta

 

>yfaP E. coli K12. Version NC_000913.3 GI:556503834
atgcgaaagatttttcttccgttgttactggtggcgctttcgcctgtcgctcacagtgaa
ggtgtgcaggaagtcgagattgatgcaccgctctcaggctggcatccggcagagggcgaa
gatgccagtttttcacaatcgatcaattacccggcgtcgtccgtcaacatggcagatgat
caaaatatctcagcgcagatccgcggcaaaataaagaattatgctgcggcgggtaaagtt
cagcagggccggctggtggtcaacggtgccagtatgccgcagagaattgaatccgatggt
tcatttgcacgcccttatattttcactgaaggcagcaacagcgtgcaggtcatcagcccg
gatgggcaaagccgacaaaaaatgcagttttactcaacgccgggtacaggaacgattcgt
gcacgtttacggctggttctctcgtgggatacggacaataccgacctcgaccttcacgtt
gttacgcccgatggcgaacacgcctggtacggtaacaccgtgctgaaaaacagtggtgca
ctggatatggatgtcacgacggggtacggacccgagattttcgccatgcccgcgccaatt
cacgggcgctatcaggtgtatatcaactactatggtgggcgcagcgaaacggaattaacc
accgcccaactgacgctgatcaccgatgaaggatcggtcaatgagaaacaggaaacattt
attgtaccgatgcgtaatgctggcgagctgacgctggtgaaaagttttgactggtga
              
                            

Download fasta file
RegulonDB