RegulonDB RegulonDB 10.8: Gene Sequence
yfaS gene sequence


Size: 4605        A: 1106  T: 1025  G: 1302  C: 1172

Fasta

 

>yfaS E. coli K12. Version NC_000913.3 GI:556503834
atggatacccaacgattccaatcccaatttcattggcatttatcgtttaaattttctggc
gcgatagcagcgtgcttgtccctgtctcttgtgggaacagggcttgctaatgctgatgat
tcgcttccttccagcaactatgcgccgcctgccgggggaacattctttttgcttgctgac
agcagttttagcagcagtgaagaggcgaaagtgcgactggaagcgccggggcgtgattat
cggcgctatcagatggaagagtacggcggcgtggacgttcgcctgtatcgtattcctgac
ccgatggcatttttgcgccagcagaaaaacctgcatcgcattgtggtgcaaccgcaatat
ctgggcgacgggctgaacaatacgctaacctggctgtgggataactggtacggcaaatct
cgccgcgtgatgcagcgtactttctcttctcagtcacggcagaatgtgactcaggcgtta
cccgaattacagctcggcaatgccattattaaaccttcccgttatgtacagaacaaccag
ttttccccgctgaaaaaatatcccctggtgaaacagttccgttatccactatggcaggct
aaaccgttcgagccgcagcaaggggtaaaactggaaggcgcatccagcaatttcatctcg
ccgcagccgggtaacatttatattcctctcggccaacaagagccgggactgtacctcgtc
gaggcgatggttggtgggtatcgggcgacgacggtggtgtttgtttccgataccgtggcg
cttagcaaagtgtcaggcaaagagcttctggtgtggaccgcgggtaaaaaacagggtgaa
gcgaagcccggctcagagatcttgtggactgacggtcttggcgtgatgacccgcggtgtg
accgatgacagcggtaccttgcagttacaacatatatcgccagaacgttcatacattctg
ggtaaggatgctgaaggcggcgtttttgtctccgagaacttcttctacgaaagcgaaatc
tacaacacccgcttgtatatttttaccgatcgcccgctatatcgcgcaggcgatcgtgtc
gatgttaaagtgatcggccgcgagttccacgatccgttgcattcatcccccatcgtcagc
gccccggcgaagctttcggtgctggacgccaacggcagtctgttgcaaaccgtcaatgtc
acgctggatgcgcgcaatggcgggcagggaagtttccgcctgccagaaaatgccgtagcc
ggaggttatgagttacgtcttgcttaccgcaatcaggtctatagcagcagttttcgcgtg
gcaaactacatcaagccacatttcgagattggtttagctctcgccaaaaaagagttcaaa
actggcgaagcggtcagcggcaaactgcaactgctctacccggatggcgagccggtaaaa
aatgcccgcgtgcagttaagtttgcgcgctcagcaattatcaatggtcggtaacgatttg
cgttatgccggacgtttccccgtgtcgctggaaggcagcgaaacggtgtccgacgccagc
ggtcatgtggcgttaaatctccccgccgccgataaaccgagccgctatttgttaaccgtc
tccgccagtgacggcgcggcgtatcgcgtcaccaccaccaaagagatcctcattgaacgc
ggtctggcgcattactcattaagtactgccgcacaatacagtaatagcggcgagtcggtt
gtgttccgttatgccgcgctggaatcttcaaaacaggttcctgttacgtatgaatggttg
cgtctcgaagaccgcacgagccatagcggagagctaccgtcaggcggcaaatcctttacc
gtcaatttcgctaaacctggcaactacaatctgacattacgcgataaagacggcttaatt
ctcgctgggttaagtcatgccgtcagcggtaagggcagcacggcgcatactggtacggta
gatatcgtggcggataaaacgctgtaccagccaggcgaaaccgcgaagatgctgattacc
tttccggagccaattgatgaagcattattgacgctggaacgcgatcgcgtggaacagcag
tcgctgctttcgcatccggcaaactggctaacgctacaacgtttaaacgatacccagtat
gaagcccgggttccagtgagcaattcctttgcgcctaacatcactttttcggtgctgtat
acccgtaacggtcagtacagttttcagaacgccgggatcaaagttgccgttccccagctg
gatatccgggtgaaaacggacaaaacccattaccagcctggtgaactggtcaatgtcgaa
ttaacctcgtcgctgaaaggtaaacctgtttctgcgcagctaacggtaggcgtggtcgat
gaaatgatctacgcgctgcaaccagaaatcgcgccgaatatcggcaaatttttctatccg
ctggggcgtaacaatgtgcgtaccagctccagtctgtcgtttatcagctacgaccaggcg
ctctccagcgagccggttgcgcctggcgcaactaaccgcagcgagcggcgagtaaaaatg
cttgaacgtccacggcgtgaagaggtggataccgcggcatggatgccgtcactcacaacc
gataaacaaggcaaagcgtatttcacgttcctgatgcctgattcgttaacccgctggcgt
atcaccgcgcgtgggatgaacggcgacgggctggtcgggcaggggcgtgcttatctgcgt
tcggaaaaaaatctctacatgaagtggagtatgccaacggtgtatcgcgtgggcgacaaa
ccggcggcaggactgtttatcttcagtcagcaggataacgaaccggtggcgctggtgact
aaatttgcaggcgctgagatgcgccagacgctgacgctgcacaaaggggcgaattatatt
tcgctgacgcagaatattcagcaatctggcttgttaagtgcagaactgcaacaaaatggg
caagtgcaggacagcattagcacaaaactgtcttttgtggataacagctggcccgttgaa
cagcagaaaaatgtcatgctcggtggtggcgataacgcgctgatgttgcccgagcaggcg
agcaatatccggctacaaagtagtgaaacgccgcaggagattttccgcaacaatcttgat
gcgttagtcgatgaaccgtggggtggcgtaatcaacaccggtagccgtctgatcccgctc
agtctcgcctggcgttcgcttgccgatcatcaaagtgccgccgctaacgacattcgtcag
atgattcaggataaccgtctgcggctgatgcaactggcggggcccggagcgcgctttacc
tggtggggtgaagatggcaatggtgacgccttccttacggcatgggcatggtacgccgac
tggcaggccagccaggcgatcggcgtaacgcaacaaccggaatactggcagcatatgctc
gacagctacgcggagcaggcagataacatgccgttattgcatcgggcgctggtgctggca
tgggcgcaggagatgaatttgccgtgcaaaacgttgttgaaagggttggatgaagctatc
gcccggcgcggaactaaaactgaagatttctctgaggaagacacccgcgatatcaatgat
agcctgatcctcgatacaccggagtctccactggcagatgcggtggcaaacgtcttaacc
atgacgttgctgaaaaaagcgcagttgaagtccacggtgatgccacaggttcagcaatat
gcgtgggataaagcggcaaacagcaatcagccgctggcgcacacggttgtgctgcttaat
agcggtggcgacgctacccagacggccgctattttaagtggtttgaccgctgagcaatcc
actattgagcgcgcgctggccatgaactggctggcgaaatatatggcgacaatgcctcca
gttgttttgcctgcgcctgcgggcgcatgggctaaacataagttaactggagggggcgaa
gactggcgttgggttggtcagggcgtgccggacattctctcttttggtgacgaattatcg
ccgcaaaatgtgcaggtccgctgacgtgagccggcaaaaatggctcaacaaagtaacatt
ccggtgaccgttgaacgccagttgtatcggcttatccctggtgaagaagagatgagcttt
attctgcaaccggtgaccagcaatgagattgacagcgatgcgctgtatctcgatgaaatc
acgcttaccagcgagcaggatgcagttctgcgctacggtcaggtggaagtaccgctgcca
ccgggagccgacgttgagcgcacaacatggggcatttcggtcaataaacccaacgccgcg
aaacagcaggggcaattgctggaaaaagcgcgaaatgaaatgggcgaactggcctatatg
gtgccggtgaaagaactgacgggaacggtcactttccgccatttgctgcgcttctcgcaa
aaagggcaattcgttctgcctcctgctcgttatgtgcgttcctatgcacctgcgcagcaa
agtgttgcggcagggagtgaatggaccgggatgcaggtgaaataa
              
                            

Download fasta file
RegulonDB