RegulonDB RegulonDB 10.8: Gene Sequence
yfaT gene sequence


Size: 624        A: 160  T: 143  G: 169  C: 152

Fasta

 

>yfaT E. coli K12. Version NC_000913.3 GI:556503834
atgaggcacgggctgctggcgctgatttgctggctgtgttgtgttgttgcccatagcgaa
atgctgaatgtcgaacaatccgggctgtttcgcgcctggtttgtacgcattgcacaagaa
cagctccgccaggggccaagtccacgctggtatcagcaggattgtgcgggcctggtgcga
tttgcggcgaacgagacgctgaaagttcacgacagtaaatggctaaaaagtaacggttta
tctagccagtatttgccgccagagatgacgctaacacctgaacagcgtcaactggcgcaa
aactggaatcaggggaacgggaaaaccggcccctatgtgaccgcgattaatttgattcag
tacaacagccagtttattggccaggacataaaccaggcgctgcctggcgatatgattttt
ttcgatcagggcgatgcccagcacttaatggtctggatggggcgttacgtcatctaccac
accggaagcgccacgaaaactgacaacggaatgcgcgcagtcagtctgcaacaacttatg
acatggaaggacacccgatggatacccaacgattccaatcccaatttcattggcatttat
cgtttaaattttctggcgcgatag
              
                            

Download fasta file
RegulonDB