RegulonDB RegulonDB 10.10: Gene Sequence
yfaV gene sequence


Size: 1290        A: 247  T: 363  G: 385  C: 295

Fasta

 

>yfaV E. coli K12. Version NC_000913.3 GI:556503834
atgagcaccgctttgcttgacgccgtggtgaagaaaaaccgtgtgcgtttaattccgttt
atgttggcgctgtatgtgctggcgtttctcgaccgttcgaatatcggttttgccaaacag
acctaccagattgataccgggttgagtaatgaagcttatgcgctgggagcaggcattttc
tttgtggtatatgcgtttctgggtgttccggcgaatcttttgatgcgcaaactgggggcc
agaacctggattggtacgacaacactgctgtggggatttctttcggcagccatggcatgg
gccgatactgaagcgaaatttctgatagttcgcactctgcttcgtgctgcggaggccgga
tttttccctggtatgatttatctcacctcgcaatggtttccgcagcgtaatcgcgccagc
attatggggctgttctatatgggcgcaccgctggcgttaacactgggatcaccgctttcc
ggcgcgctgttggagatgcatggatttatggggcatcccggctggttctggatgtttgtg
attgaaggattgttggcagtcggtgctggggtattcacattcttttggcttgatgacaca
ccggagcaggcacgttttctgagtaaacaagaaaaaacgttgcttatcaatcaactggca
agtgaagaacaacagaaagtgacttctcggctgagcgatgcgctgcgtaatggccgagtc
tggcaactagcgattatctacctgaccattcaggtggcggtttacggattaattttcttc
ctgccgacccaggttgcggcattgctgggaacaaaagtgggctttacagcgtcggtggtc
accgccattccgtgggttgcggccttgtttgggacctggcttattccgcgctattccgat
aaaaccggcgaacggcgtaatgtcgcagcgctgacattactggcggcgggcattggtatt
ggtctgtccgggctgctttctccagtaatggcgatcgtagcgctgtgtgttgcagctatc
gggtttattgccgtgcagccagtgttctggacgatgccgacacaactgctttccggtacg
gcgctggctgcgggaattggttttgtaaacctgtttggtgcagtgggcgggtttattgcc
ccgatcctgcgcgtgaaagcagaaacgttatttgccagcgatgcggcgggattactgacg
ctggcagcggtggcggtcatcggttcgctgattattttcactctgcgtgtaaatcgcact
gttgcgcagaccgacgtggcacatcattaa
              
                            

Download fasta file
RegulonDB