RegulonDB RegulonDB 10.10: Gene Sequence
yfaX gene sequence


Size: 783        A: 186  T: 198  G: 204  C: 195

Fasta

 

>yfaX E. coli K12. Version NC_000913.3 GI:556503834
atgttggaatcaagcaaagttcccgccctgacacgggctattgatattctcaatttgatt
gcccgcattggcccctgtagtgctgcgacgatcattgacacattgggaatccctaaaagc
acggcctatttgctgcttaatgaactcaggcgtcagcgttttcttagccttgatcaccag
gaaaatttttgtttgtggaccaggctggtggagctttccggtcatgcgttaagcaagatg
gatctccgggaactggctcgaccgcgtttgacgcaactgatggataccaccgggctgtta
tgtcacctggggattattgataacggcagcgcttattacattttgaaagtggagtcatca
gccactatcagcgtgcgttcccatgaaggaaaaagcctttcgctttatcgctccggaata
ggtaaatgcctgcttgcctggcaacctgcagcggtacagcaaagtattatcgaagggctg
gtctgggagcaggcgacacccacaacgattactcatccacagcaacttcacgaagaactg
gcgcgtattcgccgtcagggctggagctatgacaacggcgaagattacgccgatgtccgt
tgtgtcgctgcgccggtgtttaacgccaataacgagcttaccgctgcgatctcggtggtc
ggtacccgcttacaaatcaatgaagaataccgtgattatctggcgggcaaggccattgcc
tgcgccagggatatttcacgtctgttgggatggaaaagtccctttgacttacaagcctca
taa
              
                            

Download fasta file
RegulonDB