RegulonDB RegulonDB 10.9: Gene Sequence
yfaY gene sequence


Size: 1203        A: 265  T: 286  G: 341  C: 311

Fasta

 

>yfaY E. coli K12. Version NC_000913.3 GI:556503834
atgttaaaagtggaaatgttatccaccggggatgaagtgttacacgggcaaatcgttgac
actaacgctgcctggctggccgattttttctttcatcaggggttgccattatctcgccgc
aatacggtgggggataaccttgatgacttagtcaccattcttcgcgaacgtagtcagcac
gccgatgtgctgatcgttaacggcgggctgggaccgaccagcgatgatttaagcgcactc
gccgctgcgacagcaaaaggtgaaggcctggtgctgcatgaagcctggctcaaagagatg
gaacgctatttccacgaacgtggacgagtaatggcaccgagcaaccgtaaacaagcggag
ctgcctgccagtgctgaatttatcaataacccggtaggcaccgcctgtggttttgccgtg
cagcttaatcgttgcctgatgttctttactcccggcgtaccgtcagaatttaaggtgatg
gtcgagcacgaaatcctgccgcgcctgcgcgagcgtttttctttaccgcagccgccggtt
tgtctgcgtttgactacttttggtcgttcggaaagcgatctggcacaaagcctggacact
ctacaactgccgccgggcgtaacaatgggctatcgctcctcaatgcctatcatcgaactg
aaactcaccggaccggcaagcgagcaacaggcgatggaaaaactgtggctggatgttaaa
cgtgttgccggacagagcgtgattttcgaaggcactgaaggactgcccgcgcagatcagt
cgcgaattgcaaaaccgccagttcagcctgacgttgagcgagcaattcaccggtggttta
ttggctttgcaactttctcgcgcaggtgctccattgctggcgtgtgaagtggttccttca
caggaggaaaccctggcgcaaactgcgcactggattacagaacggcgggccaaccatttt
gccgggctggcactggctgtttcgggtttcgagaacgagcatctcaactttgcgctagcc
acgccagacggcactttcgctctgcgtgtgcgtttcagcactacgcgctacagcctggct
atccgtcaggaagtgtgcgcaatgatggcactgaatatgctgcgccgttggttaaacggc
caggatatcgccagtgagcatggctggattgaggttgttgagtccatgaccttatctgtc
tga
              
                            

Download fasta file
RegulonDB