RegulonDB RegulonDB 10.9: Gene Sequence
arnC gene sequence


Size: 969        A: 230  T: 256  G: 244  C: 239

Fasta

 

>arnC E. coli K12. Version NC_000913.3 GI:556503834
atgtttgaaatccaccctgttaagaaagtctcggtggttattcccgtttataacgagcag
gaaagcttaccggaattaatcaggcgcaccaccacagcctgtgaatcgttggggaaagag
tatgagatcctgctgattgatgacggcagtagcgataattccgcgcatatgctggtcgaa
gcctcacaagcggagaacagccatattgtgtctattttgcttaaccgcaattacgggcaa
cattcagcgattatggcgggattcagtcacgttactggcgacttaattattacccttgat
gccgatctccagaatccgccagaagaaatcccccgcctggtggcaaaagccgatgaaggt
tacgacgtggtagggactgtacgccagaaccgccaggacagctggtttcgtaaaaccgct
tcgaagatgattaaccggcttattcagcgcaccactggcaaagcgatgggtgattacggt
tgtatgctgcgcgcctatcgccgtcatattgtcgatgcgatgttgcactgccatgaacgc
agcacctttatcccgattctggcgaatatcttcgcccgccgtgccattgaaattccagta
catcatgccgagcgtgagtttggtgaatccaaatacagttttatgcgcctgattaatttg
atgtacgacctggtgacctgccttaccacaacgccgctacgtatgctgagtctgctcggc
agcattattgcgattggaggttttagcattgcggtgctgctggtgattttacgcctgacc
ttcggaccacaatgggcggcagaaggcgtctttatgctatttgccgtgctgtttactttt
attggcgctcagtttatcggcatgggattactcggtgaatatatcggcaggatctacacc
gatgtccgcgcccgcccccgctattttgttcagcaagttatccgtccatccagcaaggaa
aatgaataa
              
                            

Download fasta file
RegulonDB