RegulonDB RegulonDB 10.9: Gene Sequence
arnA gene sequence


Size: 1983        A: 476  T: 493  G: 514  C: 500

Fasta

 

>arnA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaccgtcgtttttgcctaccacgatatgggatgcctcggtattgaagccctgctg
gctgccggttacgaaattagcgccatttttacccatactgataatcccggtgaaaaagcc
ttttatggttcggtggctcgtctggcggcggaaagaggcattccggtttatgcgccggat
aacgttaatcatccgctgtgggtggaacgcattgcccaactgtcgccagatgtgattttc
tctttttattatcgccatcttatttacgacgaaattttgcagctcgctcccgcaggtgca
tttaatctgcatggttcgctgttaccaaaatatcgtggtcgcgcgccgctgaactgggtg
ctggtcaacggtgaaacggaaactggcgttacattgcaccgaatggtgaaacgtgccgat
gccggggccattgtggcgcaactgcgcattgccattgcgccagacgatatcgctattacg
ctgcatcataaattgtgccatgccgcgcgccagctactggaacagacattacccgccatt
aaacacggtaatattctggaaatcgcccagcgcgaaaacgaagccacctgttttggtcgc
agaacgccggatgacagtttccttgaatggcataaaccggcatccgtactgcacaacatg
gtacgtgccgttgccgatccgtggccgggtgccttcagctatgttggcaatcagaaattc
accgtctggtcgtcgcgtgttcatcctcatgccagcaaagcacagccggggagcgtgatt
tctgttgcgccactgctgattgcctgtggcgatggcgcgctggaaatcgtcaccggacag
gcgggcgacggcattactatgcagggctcgcaattagcgcagacgctgggcctggtgcaa
ggttcacgcttgaatagccagcctgcctgcaccgcccgacgccgtacccgggtactcatc
ctcggggtgaatggctttattggcaaccatctgacagaacgcctgctgcgcgaagatcat
tatgaagtttacggtctggatattggcagcgatgcgataagccgttttctgaatcatccg
cattttcactttgttgaaggcgatatcagtattcattccgaatggattgagtatcatgtc
aaaaaatgtgatgtcgtcttgccgctggtggcgatagccacgccgattgaatatacccgc
aacccgctgcgcgtatttgaactcgattttgaagagaatctgcgcattatccgctactgc
gtgaagtaccgtaagcgaatcatcttcccgtcaacttcagaagtttatgggatgtgtagc
gataaatacttcgatgaggaccattctaatttaatcgtcggcccggtgaataaaccacgc
tggatttattcggtatcaaaacaattacttgatcgggtgatctgggcctatggcgaaaaa
gagggtttacagttcaccctcttccgcccgtttaactggatgggaccacgactggataac
cttaatgcagcgcgaattggcagctcccgcgctattacgcaactcattctcaatctggta
gaaggttcaccgattaagctgattgatggcggaaaacaaaaacgctgctttactgatatt
cgcgatggtatcgaggcgttataccgcattatcgaaaatgcgggaaatcgctgcgacggt
gaaattatcaacattggcaatcctgagaacgaagcgagcattgaggaactgggcgagatg
ctgctggcgagcttcgaaaaacatccgctgcgccatcatttcccaccgtttgcgggcttt
cgcgttgtcgaaagtagcagctactacggcaaaggatatcaggacgtagagcatcgtaaa
ccgagcatccgcaatgcccaccgctgcctggactgggagccgaaaattgatatgcaggaa
accatcgacgaaacgctggatttcttcctgcgcaccgttgatcttacggataaaccatca
tga
              
                            

Download fasta file
RegulonDB