RegulonDB RegulonDB 11.1: Gene Sequence
arnD gene sequence


Size: 891        A: 209  T: 211  G: 253  C: 218

Fasta

 

>arnD E. coli K12. Version NC_000913.3 GI:556503834
atgaccaaagtaggcttacgcattgatgtcgatacctttcgtggcacccgtgaaggcgtg
ccgcgtctgctggaaatcttgagtaagcataatattcaggccagcatttttttcagcgtc
ggcccggacaatatgggccgccatctctggcgactggtgaagccacagtttttgtggaag
atgctgcgctcaaacgcggcatcgctttatggctgggatattttactggcaggtacggcc
tggccaggtaaagagattggtcatgccaatgccgatatcattcgtgaagcggctaaacat
cacgaagtcggcctgcacgcctgggatcaccatgcctggcaagcccgtagcggtaactgg
gatcggcaaacaatgatcgacgatattgcacgcggtcttcgcactctggaagagattatc
ggtcaaccggtaacctgttctgccgctgcgggctggcgtgccgaccagaaggtgatcgaa
gcaaaagaagcgttccatttgcgctacaacagcgattgtcgtggggccatgccgttccgt
ccattgctcgaatcaggaaaccctggcactgcgcaaattccggtgaccttacccacctgg
gatgaagtgattggtcgggatgtgaaagcagaagattttaacggttggttactcaaccgc
atcctgcgagataaaggcacgccggtttataccattcatgcagaagttgaaggctgcgct
tatcagcataattttgtggatctcctcaaacgcgcagctcaggaaggcgtgacattttgc
cctttaagcgaactgttatcagagacgttgccgctcggacaagttgttcgcggaaatatt
gccggacgtgaaggctggctgggttgccaacaaattgcgggtagtcgctga
              
                            

Download fasta file
RegulonDB