RegulonDB RegulonDB 11.1: Gene Sequence
arnF gene sequence


Size: 387        A: 75  T: 124  G: 105  C: 83

Fasta

 

>arnF E. coli K12. Version NC_000913.3 GI:556503834
atgggcctgatgtggggattattcagcgtcattattgcctcagttgcgcaattaagcctg
ggttttgcggcgagtcatctgccgccgatgacgcacttatgggattttatcgcggctctg
ttagcttttggcctggatgcccggatactgttactcgggctgctgggttatctgctttcc
gttttttgttggtataaaacgcttcataaacttgcgctaagcaaagcctatgccttgctc
agtatgagttatgtgctggtatggattgcttcaatggtacttcccggctgggaagggact
ttttcgctgaaagcactactgggagtagcctgtattatgagcgggttgatgctgattttc
ctgcccacgacaaaacaacgttactga
              
                            

Download fasta file
RegulonDB