RegulonDB RegulonDB 11.0: Gene Sequence
elaD gene sequence


Size: 1212        A: 451  T: 332  G: 202  C: 227

Fasta

 

>elaD E. coli K12. Version NC_000913.3 GI:556503834
atgatggttacagttgtcagcaattattgtcaattatctcaaacgcaactcagtcagaca
tttgcagaaaaatttactgtgaccgaggaattactgcagtctttaaaaaaaacagcgtta
tccggagatgaagaaagcattgagttactgcataatattgcgttaggttatgataaattt
gggaaagaagctgaagatattctttaccatattgttagaaccccaacaaatgagacccta
tcgattatccgacttatcaaaaatgcttgtttaaaattatataatctggcacatatcgca
accaactcccccctcaaatcacatgattcagatgatctcctgttcaaaaaactattctcc
ccttcgaaattaatgacaattatcggtgatgaaattcctcttatatctgaaaaacagtcg
ctttcaaaggtgcttttaaatgatgagaataatgaactgagtgatggtacaaacttctgg
gataaaaatcgtcaattaaccacagatgaaatagcttgctatcttcagaagatcgccgct
aatgcaaaaaatactcaagtcaattatcctactggtctctacgtcccctactccaccaga
actcacctggaagacgctctcaatgaaaatattaagagcgatccatcatggccgaatgaa
gtccagttattccccataaatactggcggacactggatattagtttcgctacagaaaata
gtaaataaaaaaaataataaactacaaataaaatgcgtcatattcaactcattgcgtgca
ctaggctatgataaagaaaattcacttaagcgtgtcattaatagttttaattctgaactc
atgggagaaatgtcgaataataatataaaagttcatttaaatgaaccagagataatattt
ttacatgccgatcttcagcaatacttaagccaaagttgcggtgcatttgtgtgcatggca
gcccaggaagtgattgaacaaagggaaagcaattctgacagcgccccctatacgttatta
aaaaaccatgctgacagatttaaaaaatattcagcagaagagcagtacgaaattgatttt
caacatcgactggcaaacagaaattgttatttagataaatatggcgatgcaaatatcaat
cattattatagaaacttagaaataaaacactcacaacccaaaaatagagcatccggcaaa
agagtgagttaa
              
                            

Download fasta file
RegulonDB