RegulonDB RegulonDB 10.9: Gene Sequence
yfbK gene sequence


Size: 1728        A: 513  T: 399  G: 442  C: 374

Fasta

 

>yfbK E. coli K12. Version NC_000913.3 GI:556503834
atgcgaaataaaaatataatcatgttgcttatgagtagtttgattttgtcaggatgtggg
ccgcaacctgagaataaggaaagtcagcaacaacaacccagtactcccacagagcagcaa
gtgcttgccgcgcagcaagctgcaataaaagaggctgagcaaagcgccgccgccgcgaaa
gccttggcccagcaagaagtgcaacaatattcagacaaacaggctttacaggggcgattg
caggaagcgccaacatttgcaagagcggctaaagcaaaagctacacatatcgcaaatcca
ggaaccgctcgctaccagcagttcgatgataatccggttaagcaggtagcgcaaaatccg
ttggcgacgtttagtcttgacgttgacactggcagttatgcgaatgtaaggcgtttcctc
aatcaagggctgttacctccgccagacgctgtgcgggtggaggagatagtcaattatttc
ccgtctgattgggatatcaaagacaaacaatctattccggcctctaagccaatacctttc
gctatgcgctacgaattggcacctgcaccatggaatgaacagcgaacattgctgaaagtt
gatatcctggcgaaagatcgcaaaagtgaagagttaccagcttctaatctggtctttctt
atcgacacttctggttcaatgatttctgatgaacgtttgccacttatccagtcttcgttg
aaattattggtcaaagaacttcgtgagcaggataacattgccatcgtgacctacgctggc
gactcccgtattgcattgccttctatctccgggagtcataaggcggaaattaatgccgca
attgattcgctggatgccgaaggcagtaccaatggcggtgccgggctggaactggcttat
cagcaggcgacgaaggggtttattaagggcggcatcaatcgcattttattagccactgac
ggtgactttaacgttggcattgacgatccaaaatcgattgaatcaatggtcaaaaaacag
cgggagtctggtgttactctgtcgacgtttggcgtggggaatagcaattacaacgaggca
atgatggtgcgaattgccgatgttggtaacggcaactacagctacattgataccctctct
gaagcgcagaaagtattgaatagtgaaatgcggcagatgttgattaccgtagcaaaagat
gtcaaagcgcaaattgagtttaaccccgcgtgggtaacggaataccgtcagattggttat
gaaaagcgccaacttcgggtggaacattttaataacgacaacgttgatgcaggggatata
ggcgcaggcaaacatataacgttgttattcgaattaacgctgaacgggcaaaaagcatca
attgataagttacgctatgccccggataacaaattagcgaaatcggacaaaacgaaagaa
ctggcctggttaaaaattcgctggaaatacccgcagggaaaagaaagtcagttagttgaa
ttcccgctggggccaacaataaacgcgccctctgaagatatgcgttttcgcgcagcagta
gctgcatatgggcaaaagttacgcggttctgaatacctgaacaatacctcctggcagcag
atcaaacagtgggctcagcaggcaaaaggggaagatccacagggttacagggcggaattt
attcgcctgattgaactggcggatggtgtgactgacatcagtcagtga
              
                            

Download fasta file
RegulonDB