RegulonDB RegulonDB 10.9: Gene Sequence
yfbL gene sequence


Size: 972        A: 261  T: 273  G: 219  C: 219

Fasta

 

>yfbL E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaataatctttgcttttattatattatttgtgtttttactccctatgattatt
ttttaccaaccctgggtcaatgcattaccgtcaacgccccgacacgcaagtcctgagcaa
ttagaaaaaacagttcgttatcttacacaaactgtgcatccacgtagtgccgacaatatt
gataatctgaataggtccgcagaatatataaaagaggtctttgtcagtagcggtgccaga
gttacctcgcaggacgtccccattacgggtggcccctacaaaaacattgttgctgattat
ggtcctgccgatggaccgctgattattattggtgcgcattatgactctgccagcagttat
gaaaacgatcaattgacctatacgccgggcgcggatgataacgccagcggtgtggcagga
ttactcgaactggcacgtttgttacatcagcaagtaccgaaaacaggcgtgcagctggtc
gcctatgcgtcggaagaaccgcccttctttcgtagcgatgaaatggggagcgcggtgcat
gcagcttcgcttgagcgtccagtgaaattaatgatagcactggagatgattggctattac
gactctgcgcctggaagccagaattacccttacccggcaatgtcctggctttatcccgat
cggggagactttattgccgtggtcggcagaatacaggatatcaacgccgttcgtcaggta
aaagcggcattgttgtcatctcaggatttatctgtttattctatgaataccccagggttt
attcccggtattgatttctctgaccacctgaattattggcaacacgatattcccgccata
atgattactgacaccgctttttatcgtaataaacaataccacttgcccggtgataccgca
gacagattgaattatcagaaaatggctcaggtagtggatggtgttataactttgttatac
aacagtaaataa
              
                            

Download fasta file
RegulonDB