RegulonDB RegulonDB 11.0: Gene Sequence
yfbM gene sequence


Size: 504        A: 138  T: 136  G: 131  C: 99

Fasta

 

>yfbM E. coli K12. Version NC_000913.3 GI:556503834
atgggaatgattggctattttgcagaaattgactcagaaaagattaaccaactgcttgag
tctactgaaaaacctttgatggataatatacatgacacgctttcaggattacgccgactg
gatattgataaacgctgggattttttacactttgggctgacaggcacctctgcttttgat
cccgcgaagaatgatccgctgagtcgtgccgtgcttggtgaacacagcctcgaagatggc
atagatggcttccttggattgacctggaatcaggagttagccgcgacaatcgaccgactg
gaatcactggatcgaaatgaactgcgtaaacagttttccattaagcgactcaatgaaatg
gagatttatccgggagtgaccttttcagaagagttagaggggcaactctttgcctcgatc
atgcttgatatggaaaagctgattagcgcgtatcgacgtatgctgcgacaagggaatcat
gcgctgacggttattgttgggtga
              
                            

Download fasta file
RegulonDB