RegulonDB RegulonDB 11.0: Gene Sequence
yfbN gene sequence


Size: 717        A: 227  T: 210  G: 169  C: 111

Fasta

 

>yfbN E. coli K12. Version NC_000913.3 GI:556503834
atggaatggttaagtgaaattcgtaaacttcggaagaacgtacctgtcggtatccaggtt
gccagacgtttgttagagaggactggcggtgatgttgatgaagccatcaagttgtttcat
attgaccaaatcaatatattgacggcaaaagcagacgtcactcatcaggaagcagagaat
gttttgttggctacaaactatgatattgcagaagctcttcggcgtattgatgaacaacgc
tatacactgacggaattgattttgcgtaaaaataaggatgccggagatgccttaaacaat
atagcattggcgattgaatatgagtgggatctcaagcgtaagttttggtttggttttgca
gatatccaattattaccgccagttttacaaacatttatgctggtttatgaatggcatgaa
tatgttggttgggaaggaatggagtgtgggatattttttgaaagtgatcatactcaccag
caattgcaagctttggggttattagaactcgcccaaaaaatggttactgcaagaatccga
tatgatgagctaaaagacaaggccgaaaattttcacgagattacagaggatgacatattc
aaaatgcttataatacattgtgaccaacttgcaagagaggttgattctatattactgcaa
tttgtgaaggacaatattgatgttttcccgtgtcgccataacagacacgagttataa
              
                            

Download fasta file
RegulonDB