RegulonDB RegulonDB 10.9: Gene Sequence
yfbO gene sequence


Size: 423        A: 117  T: 136  G: 95  C: 75

Fasta

 

>yfbO E. coli K12. Version NC_000913.3 GI:556503834
atgacacctttagaacgcattacccaacttgttaatatcaatggtgatgttaataatcct
gatactcctcgtccattgttatctcttgaggatttttttattgacaataatatccatggt
tcaatatgttgcaatgtgattccagaacaatctccgcaagctatctatcaccattttctg
aaaatacgtgagcgtaacaatgttagtgatgttttggtagaaattacgatgttcgatgac
ccagactggccctttagtgaaagtattttagttatcaccactgcttcaccagaagaagtt
cagagctggtttgtagaagaaattgcccctgatgagtgctgggaaggatggtcagaagat
acggagcatggatgggttgaagtccctgtgggtatgcatccggttacttgttggtgggat
taa
              
                            

Download fasta file
RegulonDB