RegulonDB RegulonDB 10.9: Gene Sequence
alaA gene sequence


Size: 1218        A: 298  T: 305  G: 309  C: 306

Fasta

 

>alaA E. coli K12. Version NC_000913.3 GI:556503834
atgtcccccattgaaaaatccagcaaattagagaatgtctgttatgacatccgtggtccg
gtgctgaaagaagcaaaacgcctggaagaagaaggtaacaaggtactgaaactgaacatc
ggcaacccagccccgttcggttttgacgcgccagatgaaatcctcgttgacgtgatacgc
aacctgcctaccgctcaagggtattgcgattccaaaggtctttactccgcgcgtaaagcc
atcatgcagcactaccaggctcgtggcatgcgtgatgttaccgtggaagatatttacatc
ggcaatggtgtatcggagcttatcgttcaggcaatgcaggcattgctgaacagcggggac
gaaatgttggttcctgcaccagattacccactctggaccgcggcggtttcgctttccagc
ggtaaagcggtgcattatctttgcgatgaatcctctgactggttcccggacctcgatgat
attcgcgctaaaattacgcctcgtacgcgtgggatcgttattatcaacccaaataaccca
accggcgcggtatattccaaagagcttttaatggagattgtggagattgcacgtcagcat
aatctcattatcttcgccgatgaaatttatgacaaaattctctacgacgacgctgagcat
cactcaattgcgccgctggcacctgacctgctgaccattacctttaacggactgtcgaaa
acgtaccgcgttgcaggcttccgtcaggggtggatggtgttgaacgggccgaaaaaacac
gccaaaggctacatcgaaggtctggaaatgctggcttcaatgcgcctgtgtgctaacgtt
cctgcgcaacacgccattcagaccgcgctaggtggttatcagagcatcagtgaatttatt
acccctggcggtcgtctttatgagcagcgtaaccgcgcgtgggaactgatcaacgatatt
ccgggcgtttcctgcgtgaaacctcgtggtgcgctgtatatgttcccgaaaatcgacgcc
aaacgctttaacattcacgacgatcagaaaatggtgttggatttcctgttgcaggaaaaa
gttctgttggtgcaagggacggcattcaactggccgtggccggatcacttccgcattgtc
acgctaccgcgtgtcgatgatatcgagctgtctttgagcaagttcgcgcgtttcctttct
ggttatcatcagctgtaa
              
                            

Download fasta file
RegulonDB