RegulonDB RegulonDB 10.9: Gene Sequence
yfbR gene sequence


Size: 600        A: 165  T: 139  G: 150  C: 146

Fasta

 

>yfbR E. coli K12. Version NC_000913.3 GI:556503834
atgaaacagagccatttttttgcccatctctcccgcctgaaactcattaaccgctggccg
ctcatgcgcaacgtgcggacggaaaatgtgtccgaacacagtttgcaggtagcgatggtc
gcccatgcgctggcagctatcaaaaatcgaaaatttggcggtaatgtcaacgccgaacgt
atcgctttactggcgatgtaccacgatgcctcagaagtgctcaccggcgatctccctact
ccggtgaaatacttcaattcgcaaatcgctcaggagtacaaggctattgaaaaaatcgct
cagcaaaaactggtcgatatggttccggaagagctgcgggatatctttgcgccgttaatt
gacgagcatgcatatagcgatgaagaaaaatcgctggtgaaacaggcagatgcactgtgt
gcatatctgaaatgtctggaagaactcgcggccggaaataatgaattcttgctggcaaaa
acgcgactggaagcgacgcttgaagcgcgtcgcagccaggagatggactacttcatggaa
atatttgttcccagcttccatctttcgctcgatgagattagccaggattcaccgctgtaa
              
                            

Download fasta file
RegulonDB