RegulonDB RegulonDB 10.9: Gene Sequence
yfbS gene sequence


Size: 1833        A: 337  T: 538  G: 556  C: 402

Fasta

 

>yfbS E. coli K12. Version NC_000913.3 GI:556503834
gtgaacggtgaattgatttgggttctttcattactggccgttgccatcgtcttgtttgcg
acgggcagagtgcgtatggatgcggtcgctttgtttgttattgtcgcgtttgcattaagc
ggaacgctgacagtcccagaagtattttccggcttttctgatcctaacgttgtcctgatt
gccgccttgtttattattggcgatggtttggtccgtaccggtgttgccaccgtaatggga
acatggctggtcaaagttgcgggcaatagtgaaatcaaaatgttggttttgttgatgctg
accgtcgcggggcttggcgcgtttatgagttcaaccggcgttgtcgctatctttattccc
gtggtgttaagcgttgccatgcgtatgcaaacgtcgccgtcacgtctgatgatgccgtta
agttttgccgggctgattagcggcatgatgacgctggtggcgacgccgccgaacctggta
gtcaacagtgaattgctgcgtgaaggctatcacggcttcagtttctttagcgtaacacct
attggcctggtcgtgctggtgctgggtattttgtatatgttagtgatgcgtttcatgctg
aaaggggatacccagaccccgcagcgcgaaggctggacgcgtcgaacctttcgcgatctt
atccgtgaatatcgactgaccgggcgtgcgcgacgtctggctattcgccccggatcgcca
atgattggtcaacggctggatgatctcaaattacgtgagcgttatggcgctaacgtcatc
ggtgttgaacgctggcggcgttttcgtcgcgttatcgtgaacgttaatggggtttctgaa
tttcgcgcgcgtgacgttttgcttattgatatgtctgcggctgatgtcgatctccggcaa
ttttgtagtgagcaattgctggagccgatggtactgcgcggcgagtatttttctgaccag
gcccttgatgtgggcatggcagagatttcattaattcctgagtcagaactgattggtaaa
tcggtgcgcgaaattggttttcgtacccgctacggactgaatgtggtggggctaaagcgc
aatggcgtggcgctggaaggttcgctggcggatgagcctctgctgctgggcgatatcatc
ctggttgtgggtaactggaaactgatcggtatgctggccaaacagggccgcgacttcgta
gcgctgaacttaccggaagaggtgagtgaagcatcacccgcgcacagccaggcaccccat
gccattttctgtctggtgctaatggtggcgttaatgctgacagatgaaattcctaatcct
gttgccgctatcatcgcctgcctgctgatggggaaattccgctgtatagatgctgaaagc
gcctataaatccattcactggccgagcattattttgatcgttgggatgatgccgtttgct
gtggcattacagaaaacgggaggtgtcgcgctggcggtgaaagggctgatggacattggc
ggtggttacgggccacatatgatgctggggtgtttgtttgtcttgtcggcggttattggg
ctatttatctctaataccgcgacggcggtgttgatggctccgattgcgctggctgctgcc
aaaacgatgggggtgtcgccttatccattcgcgatggtcgtggcgatggcagcatccgcc
gcctttatgacaccggtttcttcacctgttaacacactggttttaggtccgggaaattac
agcttcagtgactttgtgaagttgggggtaccgttcaccattatcgtgatggcggtttgt
gtggtgatgatcccgatgctgtttccgttttga
              
                            

Download fasta file
RegulonDB