RegulonDB RegulonDB 10.9: Gene Sequence
yfbV gene sequence


Size: 456        A: 95  T: 129  G: 117  C: 115

Fasta

 

>yfbV E. coli K12. Version NC_000913.3 GI:556503834
atgtcaacgccggataatcgttctgttaatttttttagcttgtttcgccggggacagcat
tactcaaagacgtggccgctggaaaaacgccttgccccggtctttgtcgaaaatcgcgtt
atcaagatgacgcgttatgcgatccgttttatgccgccgatcgccgtatttactctctgc
tggcagattgccctgggcggtcagcttgggccggcagttgccactgccctgttcgcctta
agtttacccatgcagggattgtggtggctgggcaagcgttctgtcacgccattaccccct
gcaatccttaactggttttatgaagttcgcggtaaattgcaggagtctggacaggtgttg
gcacccgttgaaggcaagcctgattaccaggcattagctgacacgcttaagcgcgccttc
aaacaactggataaaactttccttgatgatttgtaa
              
                            

Download fasta file
RegulonDB