RegulonDB RegulonDB 10.9: Gene Sequence
yfcC gene sequence


Size: 1521        A: 295  T: 434  G: 424  C: 368

Fasta

 

>yfcC E. coli K12. Version NC_000913.3 GI:556503834
atgtccgcaatcactgaatccaaaccaacaagaagatgggcaatgcccgatacgttggtg
attatcttttttgttgctattttaaccagccttgccacctgggtagttccggtggggatg
tttgacagtcaggaagtgcagtatcaggttgatggtcaaacaaaaacacgcaaagtcgta
gatccacactcatttcgcattctgactaacgaagcaggcgaacctgagtatcaccgcgta
cagctgttcacgacgggcgatgaacgcccgggcctgatgaacttcccgtttgaaggatta
acctcaggatcgaaatacgggacagccgttggcatcatcatgtttatgctggtgattggc
ggcgcgtttggcattgtgatgcgtacaggaaccattgataacggtatcctggcgcttatt
cgccatacccgcgggaatgaaattctctttattcctgcgctgtttattctgttttcactt
ggcggcgcggtatttggtatgggagaagaggccgtcgcctttgccattatcatcgcaccg
ctaatggtccggctgggctatgacagtattaccaccgtcctggtgacctatattgccacg
caaatcggttttgccagttcgtggatgaacccgttttgtgtggtcgttgctcaggggatt
gccggcgttccggtgctttctggctccgggttgcgcatcgtggtgtgggttatcgccact
ctgattggcctgatctttaccatggtgtacgcctcacgagtgaaaaagaatcctcttctg
tcacgcgtgcatgagtccgaccgcttctttcgtgaaaagcaggctgatgttgaacaacgt
ccgtttacctttggtgactggctggtattgattgtcctgaccgccgtaatggtctgggtg
atttggggcgtgatcgttaatgcctggtttattccagaaattgccagccagttcttcacc
atgggtctggtgattggcatcatcggcgttgttttccgccttaacggcatgacggttaat
accatggcttcatcctttaccgaaggggcgcgaatgatgatcgcccctgccctgctggtg
ggtttcgccaaagggattttgctgctggtcggtaatggtgaagcgggtgatgccagcgtg
ttaaataccatcctcaacagcattgccaatgccattagcggtctggacaacgcggtcgcg
gcctggtttatgttgctcttccaggcggtatttaatttcttcgtgacgtccggttctggt
caggcggcgttaaccatgccgttactggcaccgcttggcgatctggtcggtgttaaccgt
caggttaccgtgctggcgttccagtttggtgatggcttcagtcacatcatttacccaacc
tcagcgtcgttaatggcaacgctcggtgtgtgcagggtggacttccgtaactggctgaag
gtgggcgcgaccctacttggactgctgtttattatgtccagcgtcgtagtgatcggcgct
cagttgatgggctaccactaa
              
                            

Download fasta file
RegulonDB