RegulonDB RegulonDB 10.9: Gene Sequence
yfcD gene sequence


Size: 543        A: 140  T: 114  G: 162  C: 127

Fasta

 

>yfcD E. coli K12. Version NC_000913.3 GI:556503834
atggaacagcgtcgtttggcaagtactgaatgggtggatattgtcaatgaagagaacgaa
gtcattgcacaagccagccgggaacaaatgcgggcacagtgtctgcgtcatcgtgcaact
tacatcgtcgtgcatgatggcatgggcaaaattctggtccagcgtcgtaccgagacaaaa
gactttttacccggcatgttagatgcgaccgcaggcggtgtagtccaggccgatgagcaa
ctgctggaatccgcgcgtcgcgaagcggaagaagagttgggcattgccggtgtccccttt
gccgagcacgggcagttctatttcgaagataaaaattgccgtgtctggggcgcattgttc
agctgcgtctctcacggtcccttcgcactacaggaagatgaagtcagtgaagtttgctgg
ctgacgccggaagaaatcaccgcacgctgcgatgagttcactccagactcgctgaaagcg
ctagcgttgtggatgaagcgcaatgccaaaaatgaagccgtagagactgaaacggcagaa
tga
              
                            

Download fasta file
RegulonDB