RegulonDB RegulonDB 10.9: Gene Sequence
yfcE gene sequence


Size: 555        A: 130  T: 137  G: 158  C: 130

Fasta

 

>yfcE E. coli K12. Version NC_000913.3 GI:556503834
gtgatgaaactgatgtttgcatcggacattcatgggtcgttaccggcgacggaacgtgtt
ctggagttgtttgcccaaagcggtgcccagtggctggtgatccttggcgacgtgttgaat
cacggcccgcgtaatgctttaccggagggttacgcgccagccaaagtcgctgaacggctt
aatgaagtggcacataaggttatcgctgtgcgcggcaactgcgacagcgaagtggatcaa
atgctgctgcatttcccgataaccgcgccgtggcaacaggtattactggaaaaacaacgt
ctgtttttgacgcatggtcatctttttggcccggaaaatctgcctgctttaaaccagaac
gatgtgctggtgtacggtcatacccatctgccagtggcagaacagcggggggagattttc
cacttcaaccccggctcggtgagtattccgaaaggcggtaatccggcgagttatggcatg
ctggataatgacgtacttagtgtaatcgcactcaatgatcaaagtatcattgcgcaggtc
gcgattaatccgtaa
              
                            

Download fasta file
RegulonDB