RegulonDB RegulonDB 10.9: Gene Sequence
yfcF gene sequence


Size: 645        A: 148  T: 164  G: 181  C: 152

Fasta

 

>yfcF E. coli K12. Version NC_000913.3 GI:556503834
atgagtaaacccgctatcacgctttggtcagatgcccactttttctccccttatgtgtta
tccgcctgggtggcgttgcaggaaaaaggcctgtcgtttcatatcaagaccatcgacctc
gacagcggtgaacatttgcagccgacgtggcaaggttacggtcagacacgccgtgtgccg
ttattacaaatcgatgattttgagttgagtgaatcttctgccattgcggagtatctggaa
gatcgatttgcgccaccgacctgggaacgtatttatccgcttgatttagaaaatcgtgcg
cgtgcacgacagattcaggcctggctgcgcagcgatctgatgcccatccgcgaagagcgt
ccgacggatgttgtctttgcgggggcgaaaaaagcgccactaacggccgagggaaaagcc
agtgcagagaaactgttcgcgatggcagaacatttgttagtactgggtcagccgaattta
tttggtgaatggtgcattgctgatactgatctggcgctaatgattaaccgcctggtacta
catggcgatgaggtgccagaacgcctggtggattatgcaacattccagtggcagcgagcg
tctgtccagcgttttattgcactttcggcgaagcaatctggctga
              
                            

Download fasta file
RegulonDB