RegulonDB RegulonDB 10.8: Gene Sequence
yfcL gene sequence


Size: 279        A: 65  T: 67  G: 85  C: 62

Fasta

 

>yfcL E. coli K12. Version NC_000913.3 GI:556503834
atgatcgcggagtttgaatcacgcattctggcattaatcgacggtatggttgaccatgcc
agtgatgatgagttgtttgccagtgggtatttgcgtggccacctgacattagccatcgca
gaactggaaagtggtgatgaccactccgctcaggcggtgcatacgaccgttagccagagt
ctggaaaaagccattggtgctggtgaattgtcgccgcgtgaccaggcgctggtgaccgat
atgtgggaaaacctgtttcagcaggcgtcacagcagtaa
              
                            

Download fasta file
RegulonDB