RegulonDB RegulonDB 10.9: Gene Sequence
sixA gene sequence


Size: 486        A: 108  T: 119  G: 138  C: 121

Fasta

 

>sixA E. coli K12. Version NC_000913.3 GI:556503834
atgcaagtttttatcatgcgtcacggcgacgcagccctcgatgccgccagtgattccgtt
cgtcctctgaccactaatggttgtgacgaatctcgcctgatggcgaactggctgaaaggt
caaaaagtggaaatcgaacgcgttctggtgagcccgttcctgcgagccgagcaaacactg
gaagaagtaggggattgtctgaacctgccttccagtgcagaagttctgccggagttaacg
ccctgcggcgatgttggtctggtcagtgcctatttgcaggcgttgaccaatgaaggtgtt
gcttcggtactggtgatctctcacttaccgttagtcgggtatctggttgccgagttatgt
ccgggcgaaacgccgcctatgtttaccacctcggccattgccagcgtaacgcttgatgaa
agcggaaacggcacattcaactggcagatgagcccgtgtaatctgaagatggcaaaagct
atctga
              
                            

Download fasta file
RegulonDB