RegulonDB RegulonDB 10.9: Gene Sequence
fadI gene sequence


Size: 1311        A: 282  T: 297  G: 392  C: 340

Fasta

 

>fadI E. coli K12. Version NC_000913.3 GI:556503834
atgggtcaggttttaccgctggttacccgccagggcgatcgtatcgccattgttagcggt
ttacgtacgccttttgcccgtcaggcgacggcttttcatggcattcccgcggttgattta
gggaagatggtggtaggcgaactgctggcacgcagcgagatccccgccgaagtgattgaa
caactggtctttggtcaggtcgtacaaatgcctgaagcccccaacattgcgcgtgaaatt
gttctcggtacgggaatgaatgtacataccgatgcttacagcgtcagccgcgcttgcgct
accagtttccaggcagttgcaaacgtcgcagaaagcctgatggcgggaactattcgagcg
gggattgccggtggggcagattcctcttcggtattgccaattggcgtcagtaaaaaactg
gcgcgcgtgctggttgatgtcaacaaagctcgtaccatgagccagcgactgaaactcttc
tctcgcctgcgtttgcgcgacttaatgcccgtaccacctgcggtagcagaatattctacc
ggcttgcggatgggcgacaccgcagagcaaatggcgaaaacctacggcatcacccgagaa
cagcaagatgcattagcgcaccgttcgcatcagcgtgccgctcaggcatggtcagacgga
aaactcaaagaagaggtgatgactgcctttatccctccttataaacaaccgcttgtcgaa
gacaacaatattcgcggtaattcctcgcttgccgattacgcaaagctgcgcccggcgttt
gatcgcaaacacggaacggtaacggcggcaaacagtacgccgctgaccgatggcgcggca
gcggtgatcctgatgactgaatcccgggcgaaagaattagggctggtgccgctggggtat
ctgcgcagctacgcatttactgcgattgatgtctggcaggacatgttgctcggtccagcc
tggtcaacaccgctggcgctggagcgtgccggtttgacgatgagcgatctgacattgatc
gatatgcacgaagcctttgcagctcagacgctggcgaatattcagttgctgggtagtgaa
cgttttgctcgtgaagcactggggcgtgcacatgccactggcgaagtggacgatagcaaa
tttaacgtgcttggcggttcgattgcttacgggcatcccttcgcggcgaccggcgcgcgg
atgattacccagacattgcatgaacttcgccgtcgcggcggtggatttggtttagttacc
gcctgtgctgccggtgggcttggcgcggcaatggttctggaggcggaataa
              
                            

Download fasta file
RegulonDB