RegulonDB RegulonDB 10.9: Gene Sequence
yfcZ gene sequence


Size: 285        A: 68  T: 70  G: 76  C: 71

Fasta

 

>yfcZ E. coli K12. Version NC_000913.3 GI:556503834
atgagtaaatgtagtgctgatgaaaccccggtttgctgctgtatggatgttggcaccatt
atggacaactccgactgcaccgcgtcttacagccgcgtgtttgcaaaccgcgcagaagca
gagcaaacgctggcggcgctgactgaaaaagcccgtagcgtggaatctgaaccttgcaaa
atcaccccgactttcactgaagagtctgacggtgtgcgcctggatatcgatttcactttt
gcctgcgaagctgaaatgctgattttccagctgggtctgcgttaa
              
                            

Download fasta file
RegulonDB