RegulonDB RegulonDB 10.9: Gene Sequence
yfdG gene sequence


Size: 363        A: 80  T: 116  G: 86  C: 81

Fasta

 

>yfdG E. coli K12. Version NC_000913.3 GI:556503834
atgttaaagctatttgcaaagtacacctctattggtgtgctgaacacccttatacactgg
gtggtttttggtgtttgtatctatgtcgcgcatacaaaccaagctcttgcaaacttcgca
ggtttcgttgtggctgtgagctttagcttcttcgcgaatgcaaaattcacattcaaggca
tcgactacaacgatgcgctacatgctatatgttgggttcatggggacactgagtgctact
gttggatgggctgctgatagatgcgcacttcccccgatgataactcttgtcaccttctcc
gccatcagcctggtgtgcggtttcgtctattcaaagttcattgtctttagggatgcgaaa
tga
              
                            

Download fasta file
RegulonDB