RegulonDB RegulonDB 10.9: Gene Sequence
yfdH gene sequence


Size: 921        A: 291  T: 266  G: 212  C: 152

Fasta

 

>yfdH E. coli K12. Version NC_000913.3 GI:556503834
atgaagatatctcttgtagttcctgtcttcaatgaagaagaagcgataccaattttttat
aaaacggtacgtgaattcgaagaattgaagtcatatgaagtggaaatcgttttcataaat
gacggcagcaaagacgctacggagtcaatcattaatgctctggctgtttcagatcctcta
gttgttccgctgtcatttacacgcaactttggtaaagaaccagcattgtttgcagggtta
gaccatgcaaccggggatgcgataatcccaattgatgttgacctgcaagacccgattgag
gttattcctcatcttattgaaaaatggcaagcaggtgctgatatggttcttgctaaaaga
tctgaccgctcaactgatggacgcctgaagcgaaaaacggctgagtggttctataagctc
cacaataaaataagcaatcctaaaattgaagagaatgttggtgatttcaggctgatgagc
cgtgatgttgtcgaaaatattaaacttatgccagaacgaaaccttttcatgaaaggtatt
ctgagctgggtaggaggaaagacagatattgttgaatacgtgcgagcggaaagaattgct
ggagatacaaaatttaatggatggaaactttggaatttagcacttgagggtattacaagc
ttttccacattccctcttcgcatctggacatacatagggttagtggtagccagtgtagca
tttatttatggggcgtggatgattttagatactatcatatttggaaatgctgttagggga
tatccttcactacttgtttcaatactgtttttaggtggaattcagatgattggaatagga
gtattaggtgaatatattggacgcacatacattgaaaccaaaaaacgcccgaaatacatc
atcaagagagtcaaaaaatga
              
                            

Download fasta file
RegulonDB