RegulonDB RegulonDB 10.10: Gene Sequence
yfdK gene sequence


Size: 441        A: 130  T: 110  G: 111  C: 90

Fasta

 

>yfdK E. coli K12. Version NC_000913.3 GI:556503834
atgaattacatatattccgcgactacaaactctttctatcccttggagatgaaagaggat
tacacgcaagctggctcatggccagatgatgctgttgaagttgatgagcaagtgtatatt
gagttttccggattaccgccgaaaggaaaaatccgtatcgctggagaaaatggttttcct
gcatggtctgaaattccaccaccaacacatgaggaacagattgctgcagccgaactgaaa
aagcagcaattgattaatcaggccaacgattatatgaacagtaaacaatgggctggtaaa
gcggctattggtcgtctgaaaggtgaggaactggcgcaatataatttgtggctggattat
ctggacgcactggagctggtcgatacttccagtgcgccagatattgaatggcctactcct
ccggcagttcaggccagatga
              
                            

Download fasta file
RegulonDB