RegulonDB RegulonDB 10.10: Gene Sequence
yfdL gene sequence


Size: 519        A: 120  T: 142  G: 146  C: 111

Fasta

 

>yfdL E. coli K12. Version NC_000913.3 GI:556503834
atgttgcaggaggagctttgcagcgttgtggaggcctccggtgccagcctggagaagggg
cggcatgaccagctgcttaccgcgcttcgtgcgctgctgttaagccgcaagaatccgttt
ggcgatatcaaattggacggcacggtgcaaaaggctctcgaaaaccttggtttgggagaa
gcggctaaaagaaatgtagggacaggggcgaatcagatacctgatatgggtagttttatg
ctttctgcttcagttcctggatatcaaaaattgccatccggtttaattattcaatggggg
ccaattgatgttccgctgacgtctcaggacacagtaacctattttccgattgcatttccg
aatagatgtctgcgggtatttgcgactcaggattacactcccggcagtgcaaatgttggc
tatatagcttgtgccggttataaccaggacccggtgaaatttatttccagagcaggcgta
cccggtatcggtgcttcatttttcgcattagggtgttaa
              
                            

Download fasta file
RegulonDB