RegulonDB RegulonDB 10.10: Gene Sequence
yfdN gene sequence


Size: 495        A: 117  T: 109  G: 149  C: 120

Fasta

 

>yfdN E. coli K12. Version NC_000913.3 GI:556503834
gtgagcatgagtcttttgaatgacgttcagaaattcattgaagcccatccgggctgtact
tccggagacattgcggatgcttttgcaggttactcacggcagcgcgttctgcagtcagca
agcaagttacgtcagagtgggcgtgtggctcaccgttgtgaaggagatacacacagacat
ttcccgcgcctgactgagagagcgcaggatccggaaccacaaccagttcgtgaaaccaga
cctgtgcgcaatttctatgtcggcactaacgacccgcgggtgattttgtgcctgacccgc
caggcggaagaactggagtccaggggcttataccgtcgtgctgcaacggtgtggatggcg
gcattccgtgaaagccactcccagccagaacgaaacaattttctggcgcgtcgtgaacgg
tgtttacggaaaagcagtaagcgggctgcatcaggtgaagagtggtatctctcagggaat
tacgtgggggcttaa
              
                            

Download fasta file
RegulonDB