RegulonDB RegulonDB 10.9: Gene Sequence
yfdO gene sequence


Size: 369        A: 94  T: 68  G: 106  C: 101

Fasta

 

>yfdO E. coli K12. Version NC_000913.3 GI:556503834
ttgacctgcgcacagtggctctggaaaaaaatcatcgccctgtacgagcaggccgccgaa
tgtgacggcgaggtggttcgtcccaaagaaccgaactggacagcctgggcaaacgaaatt
cgcctgatgtgtgtgcaggatggtcgtactcacaaacaaatctgcgagatgtacagccgc
gtcagccgcgatccgttctggtgccgtaacgtgctcagcccgtcgaagctgcgggaaaaa
tgggatgagctttccctgcgcttatcgccgtccgtcagcacgtacacagaaaaacgcgaa
gacccgtacttcaaagccagttacgacaatgtggactacagccagatcccggcaggattc
agggggtga
              
                            

Download fasta file
RegulonDB