RegulonDB RegulonDB 10.10: Gene Sequence
yfdQ gene sequence


Size: 825        A: 225  T: 223  G: 188  C: 189

Fasta

 

>yfdQ E. coli K12. Version NC_000913.3 GI:556503834
atgtctcagaacttagacgcaaccgcaattaatcaaatccatgcccttatttctgctcag
ggtgttaatgaaattatcagtaagattggtgccgatgctgtggcattgcctgagaatttc
cgcattcatgatctggaaaaatttaatttaaatcgcttccgtttccgtggtgcgctttcc
actgccagcatcgatgactttacccgttattctaaagatcttgcagatgaaggcacccgc
tgctttatcgatgctgataatatgcgtgccgtcagtgtgcttaacctgggtactattgat
gaaccaggtcacgcagataacaccgccactctcaaactgaaaaagacagcaccgttctct
gccctgttgtctgttaacggcgagcgtaactcccagaaatcactggcagaatggattgaa
gactgggccgactaccttgtgggctttgatgctaatggtgacgccattcaggcaacaaaa
gcggctgcggcaatccgtaaaatcacgattgaagcaaaccagaccgctgattttgaagat
aatgacttcagcggcaaacgctccctgatggaatctgtcgaagcgaagaccaaagacatt
atgccagtggcatttgaatttaaatgcgttccgtttgaaggtctgaaagaacgtccgttt
aaattacgcctcagcattatcactggcgatcgtcctgtactggttctgcgcattattcag
ctggaagcggtgcaggaagatatggctaacgaatttcgtgatctgcttgttgagaaattc
aaagacagcaaagtagaaacctttattggtactttcaccgcctga
              
                            

Download fasta file
RegulonDB