RegulonDB RegulonDB 10.9: Gene Sequence
yfdR gene sequence


Size: 537        A: 141  T: 148  G: 123  C: 125

Fasta

 

>yfdR E. coli K12. Version NC_000913.3 GI:556503834
atgtcatttattaaaactttttccgggaagcatttttattatgacaagataaataaagac
gacatcgtgattaacgatatcgcggtttccctttcaaatatctgccgctttgccggtcat
ctttctcacttctacagtgtcgcccaacatgcggtgctttgcagccagctggtgccgcag
gaatttgcttttgaagcattaatgcatgatgcaacagaagcgtattgccaggacatcccc
gcaccactgaaacgccttcttcctgactataaacggatggaagaaaaaatagatgcagta
atccgtgagaaatacgggttacctcctgttatgagcacgccagtgaaatatgccgatctc
attatgctggcaaccgaacgccgtgatctcgggcttgatgatggctctttctggcctgta
ctggaaggcatcccggcaacagagatgttcaacgtgattccactggcaccgggtcatgcc
tacgggatgtttatggaacgttttaacgatttatcggagttacgcaaatgcgcatga
              
                            

Download fasta file
RegulonDB