RegulonDB RegulonDB 10.9: Gene Sequence
yfdS gene sequence


Size: 363        A: 111  T: 81  G: 101  C: 70

Fasta

 

>yfdS E. coli K12. Version NC_000913.3 GI:556503834
atgcgcatgaatgttttcgaaatggaagggtttcttcgcgggaaatgtgtaccgcgagat
ctgaaagtgaacgaaacaaatgctgagtacctggtacgtaaattcgacgcgcttgaagct
aaatgtgcggcactggaaaacaaaataataccagtgtcagctgaactgccaccagcaaat
gaaagtgttctgttatttgatgctaacggagaaggctggctgattggctggcgttctctc
tggtacacctggggacaaaaagaaaccggagaatggcagtggacatttcaggttggggac
cttgaaaacgtcaatatcactcactgggcagtaatgccaaaagcaccggaggctggagca
taa
              
                            

Download fasta file
RegulonDB