RegulonDB RegulonDB 10.10: Gene Sequence
yfdT gene sequence


Size: 306        A: 106  T: 69  G: 73  C: 58

Fasta

 

>yfdT E. coli K12. Version NC_000913.3 GI:556503834
atgaccacatttaccaataaagaactgattaaagaaatcaaagaacgaatcagcagccta
gaggttcgagacgatattgagcgccgtgcttatgaaatcgcactcgtatctctggaagta
gagccagatgaacgcgaagcctatgaattattcatggaaaagcgtttcggtgacttagta
gatcgtcggagagcaaaaaacggcgataacgaatacatggcatgggatatgactctcggt
tggatcatctggcagcaacgagctggtatccatttttcaacaatgtcacaacaagaggtg
aaataa
              
                            

Download fasta file
RegulonDB