RegulonDB RegulonDB 10.9: Gene Sequence
emrK gene sequence


Size: 1164        A: 373  T: 303  G: 257  C: 231

Fasta

 

>emrK E. coli K12. Version NC_000913.3 GI:556503834
gtggaacagattaattcaaataaaaaacattctaacagaagaaaatacttttctttattg
gcggtagttttatttattgcgttttcaggtgcctatgcctattggtcaatggaattagaa
gacatgattagtacagatgacgcctatgtcacggggaatgcagatccaatttctgcacaa
gtctcaggtagtgtcactgtcgttaatcataaagatacgaactacgttcgacaaggtgac
attttagtttcactggataaaactgatgccactatcgcactcaataaagctaaaaataat
ctggcaaatattgttcggcaaacgaataaactatacttacaggataaacaatacagtgcc
gaagtcgcttcagcacgtattcagtatcaacaatctttagaagattataaccgtcgagtg
ccgttagcgaagcagggggttatttcaaaagaaacgctggagcataccaaagatacgtta
ataagtagcaaagcggcattgaatgccgctatccaggcttataaagcgaataaagcttta
gtaatgaacacaccattaaaccgtcagccacaagtcgttgaagcggcggatgcaactaaa
gaagcctggttggcgcttaaacgtacggatattaagagtccggttaccggctatattgcc
cagagaagtgttcaggtcggcgaaacagtgagccccggacaatcgttaatggctgtcgta
ccggcacgtcaaatgtgggttaatgccaactttaaagaaacacaactcacggatgtacgg
attggtcaatcggtcaatattatcagcgatctttatggtgaaaatgttgtgtttcatggt
cgggtgacagggatcaatatgggaaccggcaatgcgttctccttattacctgcacaaaat
gcgacagggaactggatcaaaatcgttcagcgtgtaccggttgaagtttctcttgatcca
aaagaactcatggaacaccccttgcgtattggtttatcgatgacagcaactattgatacg
aagaacgaagacattgccgagatgcctgagctggcttcaaccgtgacctccatgccggct
tataccagtaaggctttagttatcgataccagtccgatagaaaaagaaattagcaacatt
atttcgcataatggacaactttaa
              
                            

Download fasta file
RegulonDB