RegulonDB RegulonDB 10.9: Gene Sequence
alaC gene sequence


Size: 1239        A: 278  T: 280  G: 362  C: 319

Fasta

 

>alaC E. coli K12. Version NC_000913.3 GI:556503834
atggctgacactcgccctgaacgtcgctttacgcgcattgatcgtctcccgccctacgtt
tttaacatcaccgctgaactgaaaatggctgcgcgtcggcgcggcgaagatattatcgat
ttcagcatgggtaacccggacggtgcgactccgccgcatatcgtcgaaaaattatgtact
gtggcccagcgcccggacacgcatggttactccacttcacgcggcattccgcggttacgt
cgcgccatttcccgctggtatcaggatcgctacgacgttgaaatcgacccggaatcagaa
gccatcgtcactattggttcgaaagagggcctggcgcatctgatgctggcgacgctggat
catggtgacacggtgctggtgccgaatccaagttacccgatccatatttatggcgcggtg
attgccggggcgcaggtacgctcagtgccgctggtggaaggtgtcgatttcttcaacgaa
ctggagcgagccattcgtgaaagttatccgaaaccgaagatgatgatcctcggcttcccg
tcaaacccaaccgcgcaatgcgtggaactggagttcttcgaaaaagtagtggcgctggcg
aaacgctacgatgtgctggtggtccatgacctggcctatgccgatatcgtctacgatggc
tggaaagcgccgtcaattatgcaggtaccgggtgcacgcgatgtggcagtcgagttcttt
acgctgtcgaaaagctacaacatggcgggctggcgtatcggctttatggttggcaacaaa
acgctggtcagcgccctggctcgtattaaaagctatcacgattacggcacctttacgccg
ttgcaggtggcggcgattgcggcgctggagggcgatcaacagtgcgtgcgcgacattgcc
gaacagtacaaacgccgccgtgatgtattggttaaagggctgcatgaagcgggctggatg
gttgaaatgccgaaggcttcgatgtatgtctgggcgaaaatcccggaaccatatgcggcc
atgggatcgctggaatttgccaagaagctccttaacgaagcgaaggtttgtgtctcgccg
gggattggctttggcgactatggtgatacgcatgttcgctttgcactgattgaaaaccgc
gaccgtattcgtcaggccatcagagggattaaagcgatgttccgtgccgacggtttacta
cccgccagcagcaaacatattcacgaaaacgcggaataa
              
                            

Download fasta file
RegulonDB