RegulonDB RegulonDB 10.9: Gene Sequence
ypdE gene sequence


Size: 1038        A: 216  T: 217  G: 333  C: 272

Fasta

 

>ypdE E. coli K12. Version NC_000913.3 GI:556503834
atggatttatcgctattaaaagcgttgagcgaggcagatgcgatcgcctcctcggaacag
gaagtgcggcagatcctgctggaagaagcggatcgcctgcaaaaagaagtgcgatttgat
ggtctgggatcggtgctgatccgcctgaatgaatcgacaggtccgaaggtgatgatctgt
gcgcatatggacgaagtgggatttatggtgcgcagcatctcccgcgaaggggcgattgat
gtgctgccggttggcaacgtacgcatggctgcccgccagctgcagccggtgcgcatcacc
acccgtgaagagtgcaaaattccaggcctgcttgacggcgaccggcaggggaatgacgtc
agcgccatgcgcgtggacattggtgcgcgctcctatgacgaagtgatgcaggcgggaatt
cgtcccggcgatcgcgtcacgtttgataccacttttcaggttctccctcaccagcgagtg
atggggaaagcctttgatgaccgcctcggttgctatctgctggtgacgttactgcgcgaa
ctgcacgacgccgaactacctgcggaagtgtggctggtggcaagttccagcgaagaggtg
ggattacgcggcgggcaaactgccacccgcgcggtgtcgccggacgtcgccattgtgctt
gataccgcctgctgggcgaaaaactttgattatggcgcggctaaccatcgccagattggt
aacgggccgatgctggtgttaagcgacaagtcgctgattgcgccgccaaaacttaccgcc
tgggtcgaaaccgtggcggcagaaattggcgtgccgttgcaggcagatatgttcagcaac
ggcggcacggacggcggggcggtgcacttaaccggcaccggcgtgcccacagtggtgatg
gggccagcaacccgccatggacattgcgccgcatcgattgccgattgccgcgacattttg
cagatgcagcaacttttatctgcccttattcaacgtcttacgcgtgagacggttgttcaa
ctgacggatttcagatga
              
                            

Download fasta file
RegulonDB