RegulonDB RegulonDB 10.9: Gene Sequence
ypdF gene sequence


Size: 1086        A: 237  T: 232  G: 330  C: 287

Fasta

 

>ypdF E. coli K12. Version NC_000913.3 GI:556503834
atgacattactcgcttcgctgcgcgactggcttaaggcgcaacaactggatgcagtgctt
ctctcctcacggcagaacaaacagccgcatctggggatctccaccggatcaggttatgtg
gtgattagccgtgaaagtgcgcacattctggtggattcgcgctattacgttgaggtggaa
gcccgtgcgcaaggctaccagctgcatttgcttgacgcgacgaacacgcttaccactatc
gtcaatcaaatcattgccgatgaacagttgcaaacgctcggttttgagggccagcaggtg
agttgggaaaccgcgcaccgctggcagtctgaactcaatgcgaaactggttagcgccacg
ccggatgtgctgcggcaaatcaaaacgccagaggaggtggagaaaatccgcctcgcctgt
gggattgctgatcgcggtgcagagcatattcgccgctttattcaggcggggatgagcgag
cgcgagatagccgctgaactggagtggtttatgcgccagcagggcgcagaaaaagcctct
tttgacaccattgtcgccagtggctggcgtggggcgctgccgcacggcaaagccagcgac
aagattgttgcagcgggcgagtttgtcactctcgatttcggtgcgctgtatcagggctac
tgctctgatatgacgcgcaccttgctggtgaatggcgaaggggtgagcgccgaatctcac
ctgctgtttaacgtctatcaaattgtcctgcaggcacagctcgcagcaatctccgcgatt
cgccccggcgtgcgctgccagcaggttgacgatgccgcgcgccgggtcattacagaagca
ggttatggcgactatttcggtcataacaccggtcacgctatcggcattgaagttcatgaa
gatccgcgtttttcaccgcgggacaccacgacgctacagccaggcatgttactgaccgtg
gagccggggatttatttgccagggcaagggggcgtgcgcatcgaagatgttgtgctggtt
accccgcaaggcgcagaagtgctctacgccatgccgaaaacagtgttgctcacgggagag
gcataa
              
                            

Download fasta file
RegulonDB