RegulonDB RegulonDB 10.9: Gene Sequence
mntH gene sequence


Size: 1239        A: 231  T: 348  G: 381  C: 279

Fasta

 

>mntH E. coli K12. Version NC_000913.3 GI:556503834
atgacgaactatcgcgttgagagtagcagcggacgggcggcgcgcaagatgaggctcgca
ttaatgggacctgcgttcattgcggcgattggttatatcgatcccggtaactttgcgacc
aatattcaggcgggtgctagcttcggctatcagctactgtgggttgtcgtttgggccaac
ctgatggcgatgctgattcagatcctctctgccaaactagggattgccaccggtaaaaat
ctggcggagcagattcgcgatcactatccgcgtcccgtagtgtggttctattgggttcag
gcagaaattattgcgatggcaaccgacctggcggaatttattggtgcggcgatcggtttt
aaactcattcttggtgtttcgttgttgcagggcgcggtgctgacggggatcgcgactttc
ctgattttaatgctgcaacgtcgcgggcaaaaaccgctggagaaagtgattggcgggtta
ctgttgtttgttgccgcggcttacattgtcgagttgattttctcccagcctaacctggcg
cagctgggtaaaggaatggtgatcccgagtttacctacttcggaagcggtcttcctggca
gcaggcgtgttaggggcgacgattatgccgcatgtgatttatttgcactcctcgctcact
cagcatttacatggcggttcgcgtcaacaacgttattccgccaccaaatgggatgtggct
atcgccatgactattgccggttttgtcaatctggcgatgatggctacagctgcggcggcg
ttccacttttccggtcatactggtgttgccgatcttgatgaggcttatctgacgctgcaa
ccgctgttaagccacgctgcggcaacggtctttggattaagcctggttgctgcggggctg
tcttcaacggtggtggggacactggcggggcaggtggtgatgcagggcttcattcgcttt
catatcccgctgtgggtgcgtcgtacagtcaccatgttgccgtcatttattgtcattctg
atgggattagatccgacacggattctggttatgagtcaggtactgttaagttttggtatc
gctctggcgctggttccactgctgattttcaccagtgacagcaagttgatgggcgatctg
gtgaacagcaaacgcgtaaaacagacaggctgggtgattgtggtgctggtcgtggcgctg
aatatctggttgttggtggggacggcgctgggattgtag
              
                            

Download fasta file
RegulonDB